🔥 | Latest

Do It Again, Martin, and Memes: Carl Anthony Payne Says He's All for a 'Martin' Reboot, Thinks It's Long Overdue @balleralert Carl Anthony Payne Says He’s All for a ‘Martin’ Reboot, Thinks It’s Long Overdue - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Well, it may be safe to say that the possibility of a ‘Martin’ reboot is headed in the right direction… and everyone seems to be on board with it. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Over the weekend, TMZ caught up with CarlAnthonyPayne—who portrayed the role of ‘Cole Brown’ in the original series, and when asked about the promising project, he actually gave some hopeful responses. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “People are talking. We’re all talking,” he said, hesitantly, walking out of Mastro’s. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Although it did appear that Payne didn’t want to give “too much” information away, he didn’t exactly say “no” either. In fact, he said that he wouldn’t be opposed to the idea of bringing ‘Martin’ back at all. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “Absolutely. Why not? I think the people want it. I think it’s long overdue. We created magic in a bottle. You know? Why not do it again?” The 48-year-old told TMZ. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However, many have wondered if the reboot would be available through a particular streaming service or a television network. According to Payne, he’s rooting for Netflix. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “You know what? I think [Netflix] would be a good home for it. There’s a lot of room to grow there. It would be smarter, better, and funnier.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As of now, the specifics are unknown. But, hopefully, we’ll know more soon-if it really happens. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Rumors of a ‘Martin’ reboot have been swirling for quite some time now, but they recently resurfaced when MartinLawrence’s fiancée, Roberta Moradfar, let the cat out of the bag that Lawrence spilled the beans to her about it. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ That following week, Lawrence was photoed out with co-stars Tisha Campbell-Martin and Tichina Arnold, which sparked more speculation.
Do It Again, Martin, and Memes: Carl Anthony Payne Says
 He's All for a 'Martin' Reboot,
 Thinks It's Long Overdue
 @balleralert
Carl Anthony Payne Says He’s All for a ‘Martin’ Reboot, Thinks It’s Long Overdue - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Well, it may be safe to say that the possibility of a ‘Martin’ reboot is headed in the right direction… and everyone seems to be on board with it. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Over the weekend, TMZ caught up with CarlAnthonyPayne—who portrayed the role of ‘Cole Brown’ in the original series, and when asked about the promising project, he actually gave some hopeful responses. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “People are talking. We’re all talking,” he said, hesitantly, walking out of Mastro’s. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Although it did appear that Payne didn’t want to give “too much” information away, he didn’t exactly say “no” either. In fact, he said that he wouldn’t be opposed to the idea of bringing ‘Martin’ back at all. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “Absolutely. Why not? I think the people want it. I think it’s long overdue. We created magic in a bottle. You know? Why not do it again?” The 48-year-old told TMZ. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However, many have wondered if the reboot would be available through a particular streaming service or a television network. According to Payne, he’s rooting for Netflix. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “You know what? I think [Netflix] would be a good home for it. There’s a lot of room to grow there. It would be smarter, better, and funnier.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As of now, the specifics are unknown. But, hopefully, we’ll know more soon-if it really happens. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Rumors of a ‘Martin’ reboot have been swirling for quite some time now, but they recently resurfaced when MartinLawrence’s fiancée, Roberta Moradfar, let the cat out of the bag that Lawrence spilled the beans to her about it. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ That following week, Lawrence was photoed out with co-stars Tisha Campbell-Martin and Tichina Arnold, which sparked more speculation.

Carl Anthony Payne Says He’s All for a ‘Martin’ Reboot, Thinks It’s Long Overdue - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Well, it may be...

Advice, Future, and Ironic: eggrollie art has been hard lately but i made this banana today and its probably the height of my ability and i am ready novw a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think about what you’re motivated to do, your affinity, your aspirations. what are the core reasons for your motivation? 2. impact is everything - if everything works out exactly as expected, why does it matter? what will you learn or change? 3. be James Bond - expose the side of yourself that will be received best. you don’t need to reveal everything about yourself upfront. 4. create strong partnerships - build a wise council. you only need three people: one who is a few steps ahead of you or where you want to be in the future, one who is progressing at the same pace as you, and one who is behind you but has experienced more. 5. to make space for what matters, you have to say no - we aren’t self-aware enough to know our breaking point before we reach it, so don’t be afraid to pass on some things. 6. create meaningful time - bingeing is not productive. establish clear morning rituals and practice contingency management. a slow and steady schedule is best. 7.when you rush from A to B, you miss everything in between - slow down and forget about your destination. take time to appreciate the path you’re on. 8.”the chief enemy of creativity is good sense” - be creative. just don’t lose touch with your common sense. 9.it’s supposed to be fun most of the time or something’s wrong - there will be spontaneous emotional breakdowns and seemingly impassible obstacles, but enjoy the journey of life billsimportantposts
Advice, Future, and Ironic: eggrollie
 art has been hard lately but i made this banana today and its probably the
 height of my ability and i am ready novw
a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think about what you’re motivated to do, your affinity, your aspirations. what are the core reasons for your motivation? 2. impact is everything - if everything works out exactly as expected, why does it matter? what will you learn or change? 3. be James Bond - expose the side of yourself that will be received best. you don’t need to reveal everything about yourself upfront. 4. create strong partnerships - build a wise council. you only need three people: one who is a few steps ahead of you or where you want to be in the future, one who is progressing at the same pace as you, and one who is behind you but has experienced more. 5. to make space for what matters, you have to say no - we aren’t self-aware enough to know our breaking point before we reach it, so don’t be afraid to pass on some things. 6. create meaningful time - bingeing is not productive. establish clear morning rituals and practice contingency management. a slow and steady schedule is best. 7.when you rush from A to B, you miss everything in between - slow down and forget about your destination. take time to appreciate the path you’re on. 8.”the chief enemy of creativity is good sense” - be creative. just don’t lose touch with your common sense. 9.it’s supposed to be fun most of the time or something’s wrong - there will be spontaneous emotional breakdowns and seemingly impassible obstacles, but enjoy the journey of life billsimportantposts

a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think ab...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...