🔥 | Latest

Anaconda, Bailey Jay, and Billboard: Remembering Legendary Singer and lcon, Whitney Houston @balleralert Remembering Legendary Singer and Icon, Whitney Houston - blogged by @lanaladonna (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It’s been six years since the death of legendary singer, actress, producer, and model, WhitneyHouston. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston died at 48 in 2012 after being found unconscious in a bathtub in a Beverly Hills hotel. It was reported that the singer passed due to cocaine use and heart disease. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s legacy included winning six Grammys and selling 170 million albums, singles, and videos over her career. Whitney, to this day, is the only artist to chart seven consecutive No. 1 Billboard Hot 100 songs and is the only woman to have two number-one Billboard 200 album awards. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston made her acting debut in “The Bodyguard” in 1992, where she performed the lead single from the film’s soundtrack, ‘I Will Always Love You.’ The song easily became a highlight of Houston’s career, and one of her signature records. It received the Grammy Award for Album of the Year in 1994. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s pursuit in acting didn’t stop there. Aside from her appearance in Disney’s ‘Cinderella,’ she landed leading roles in ‘Waiting to Exhale’ and ‘The Preacher’s Wife.’ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Whitney’s career contributed to breaking the color barrier that so many African-American artists faced. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On this day we remember her legacy, career, angelic voice, and the contributions she made to the entertainment industry as we know it. Houston left behind her mother, two brothers, and her daughter Bobbi Kristina, who died three years later. ⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀ May Whitney Houston continue to Rest In Peace!
Anaconda, Bailey Jay, and Billboard: Remembering Legendary Singer and
 lcon, Whitney Houston
 @balleralert
Remembering Legendary Singer and Icon, Whitney Houston - blogged by @lanaladonna (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It’s been six years since the death of legendary singer, actress, producer, and model, WhitneyHouston. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston died at 48 in 2012 after being found unconscious in a bathtub in a Beverly Hills hotel. It was reported that the singer passed due to cocaine use and heart disease. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s legacy included winning six Grammys and selling 170 million albums, singles, and videos over her career. Whitney, to this day, is the only artist to chart seven consecutive No. 1 Billboard Hot 100 songs and is the only woman to have two number-one Billboard 200 album awards. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston made her acting debut in “The Bodyguard” in 1992, where she performed the lead single from the film’s soundtrack, ‘I Will Always Love You.’ The song easily became a highlight of Houston’s career, and one of her signature records. It received the Grammy Award for Album of the Year in 1994. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s pursuit in acting didn’t stop there. Aside from her appearance in Disney’s ‘Cinderella,’ she landed leading roles in ‘Waiting to Exhale’ and ‘The Preacher’s Wife.’ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Whitney’s career contributed to breaking the color barrier that so many African-American artists faced. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On this day we remember her legacy, career, angelic voice, and the contributions she made to the entertainment industry as we know it. Houston left behind her mother, two brothers, and her daughter Bobbi Kristina, who died three years later. ⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀ May Whitney Houston continue to Rest In Peace!

Remembering Legendary Singer and Icon, Whitney Houston - blogged by @lanaladonna (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It’s been six years since the death...

Albert Einstein, America, and Blackhistory: Albert Einstein teaching a physics class at Lincoln University (HBCU in Pennsylvania) in 1946. The Nobel prize winning scientist said: "The separation of the races is not a disease of colored people. It is a disease of white people. I do not intend to be quiet about it." Repost @theblaquelioness - Six Ways Albert Einstein Fought for Civil Rights. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 1. Shortly before moving to America, Einstein backed a campaign to defend the Scottsboro Boys, nine Alabama teenagers who were falsely accused of rape in 1931. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 2. When Princeton's Nassau Inn refused to rent a room to contralto opera star Marian Anderson because of her skin color, Einstein invited the singer home as his guest. Their friendship lasted from 1937 until his death in 1955, and Anderson stayed with the Einsteins whenever she visited Princeton. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 3. In 1946, Einstein gave a rare speech at Lincoln University in Pennsylvania, a historically black university, where he also accepted an honorary degree. The appearance was significant because Einstein made a habit of turning down all requests to speak at universities. During his speech, he called racism "a disease of white people." ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 4. Einstein was a friend and supporter of African-American actor and singer Paul Robeson, who was blacklisted because of his civil rights work. The pair worked together in 1946 on an anti-lynching petition campaign. In 1952, when Robeson's career had bottomed out because of the blacklisting, Einstein invited Robeson to Princeton as a rebuke to the performer's public castigation. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 5. For decades, Einstein offered public encouragement to the National Association for the Advancement of Colored People (NAACP) and its founder, W. E. B. Du Bois. And in 1951, when the federal government indicted the 83-year-old Du Bois as a "foreign agent," Einstein offered to appear as a character witness during the trial. The potential publicity convinced the judge to drop the case. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 6. In January 1946, Einstein published an essay, "The Negro Question," in Pageant magazine in which he called racism America's "worst disease." . AlbertEinstein BlackHistory BlackHistoryMonth BlackBoyJoy BlackGirlMagic physics einstein science history pennsylvania
Albert Einstein, America, and Blackhistory: Albert Einstein teaching a physics class at
 Lincoln University (HBCU in Pennsylvania)
 in 1946. The Nobel prize winning scientist
 said: "The separation of the races is not a
 disease of colored people. It is a disease of
 white people. I do not intend to be quiet
 about it."
Repost @theblaquelioness - Six Ways Albert Einstein Fought for Civil Rights. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 1. Shortly before moving to America, Einstein backed a campaign to defend the Scottsboro Boys, nine Alabama teenagers who were falsely accused of rape in 1931. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 2. When Princeton's Nassau Inn refused to rent a room to contralto opera star Marian Anderson because of her skin color, Einstein invited the singer home as his guest. Their friendship lasted from 1937 until his death in 1955, and Anderson stayed with the Einsteins whenever she visited Princeton. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 3. In 1946, Einstein gave a rare speech at Lincoln University in Pennsylvania, a historically black university, where he also accepted an honorary degree. The appearance was significant because Einstein made a habit of turning down all requests to speak at universities. During his speech, he called racism "a disease of white people." ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 4. Einstein was a friend and supporter of African-American actor and singer Paul Robeson, who was blacklisted because of his civil rights work. The pair worked together in 1946 on an anti-lynching petition campaign. In 1952, when Robeson's career had bottomed out because of the blacklisting, Einstein invited Robeson to Princeton as a rebuke to the performer's public castigation. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 5. For decades, Einstein offered public encouragement to the National Association for the Advancement of Colored People (NAACP) and its founder, W. E. B. Du Bois. And in 1951, when the federal government indicted the 83-year-old Du Bois as a "foreign agent," Einstein offered to appear as a character witness during the trial. The potential publicity convinced the judge to drop the case. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 6. In January 1946, Einstein published an essay, "The Negro Question," in Pageant magazine in which he called racism America's "worst disease." . AlbertEinstein BlackHistory BlackHistoryMonth BlackBoyJoy BlackGirlMagic physics einstein science history pennsylvania

Repost @theblaquelioness - Six Ways Albert Einstein Fought for Civil Rights. ┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈┈ 1. Shortly before moving to America, Eins...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

America, Bodies , and Food: GRIND NOW SHINE LATER Check out how @davis_008 turned his passion into a REAL business👇 We all have passions. For some, it's a sport or activity. For others, it's a topic or a “thing.” Many of us dream about turning our passions into business ideas, but most of us have no idea how to even get started! - Davis is a young entrepreneur born and raised in Peru (South America) who at the age of 15 lost his father due to a disease and with no other options his mother made the decision to immigrate to the United States looking for a better future. - It was surely not easy to start from zero and to adapt to a completely new culture or language, but growing up with two hard-working parents who taught him great values and preservation, Davis never gave up and was ready to overcome any challenge. - Losing his father due to a disease, awakened the interest to find different healthy foods, methods and resources to heal and make our bodies perform in an optimum way, an interest which became a PASSION for fitness, nutrition and the practice of healthy habits. - Understanding the importance and the power of food, Davis was aware of the AMAZING resources his native country (Peru) had to offer to the world 🌎 and looking for ways to make it available to everyone, he created his first supplement company: Apu Nutrition INC @apunutrition 🍃 And as a first supplement he choose a superfood called “Maca” an amazing root with tons of great benefits for our bodies. Davis spent MONTHS on research and development, flew multiple times to Peru looking for the best quality and resources to provide his customers with a PREMIUM and exclusive blend. I personally take it almost every day and love it! - Be sure to drop some love on his new business page @apunutrition - Follow the KING of MACA @davis_008 and join him on this amazing journey! (He’s just getting started 🔥) 👉 @davis_008
America, Bodies , and Food: GRIND NOW
 SHINE LATER
Check out how @davis_008 turned his passion into a REAL business👇 We all have passions. For some, it's a sport or activity. For others, it's a topic or a “thing.” Many of us dream about turning our passions into business ideas, but most of us have no idea how to even get started! - Davis is a young entrepreneur born and raised in Peru (South America) who at the age of 15 lost his father due to a disease and with no other options his mother made the decision to immigrate to the United States looking for a better future. - It was surely not easy to start from zero and to adapt to a completely new culture or language, but growing up with two hard-working parents who taught him great values and preservation, Davis never gave up and was ready to overcome any challenge. - Losing his father due to a disease, awakened the interest to find different healthy foods, methods and resources to heal and make our bodies perform in an optimum way, an interest which became a PASSION for fitness, nutrition and the practice of healthy habits. - Understanding the importance and the power of food, Davis was aware of the AMAZING resources his native country (Peru) had to offer to the world 🌎 and looking for ways to make it available to everyone, he created his first supplement company: Apu Nutrition INC @apunutrition 🍃 And as a first supplement he choose a superfood called “Maca” an amazing root with tons of great benefits for our bodies. Davis spent MONTHS on research and development, flew multiple times to Peru looking for the best quality and resources to provide his customers with a PREMIUM and exclusive blend. I personally take it almost every day and love it! - Be sure to drop some love on his new business page @apunutrition - Follow the KING of MACA @davis_008 and join him on this amazing journey! (He’s just getting started 🔥) 👉 @davis_008

Check out how @davis_008 turned his passion into a REAL business👇 We all have passions. For some, it's a sport or activity. For others, it's...

Abc, Doctor, and Family: California Girl Dies From Deadly Infection After Being Misdiagnosed With Flu @balleralert California Girl Dies From Deadly Infection After Being Misdiagnosed With Flu - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ A 12-year-old California girl lost her life after her mother said a doctor misdiagnosed a deadly infection with the flu. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Dec. 17, Alyssa Alcaraz died in Kaweah Delta Medical Center in Visalia, California, from an infection called sepsis which kills more than 250,000 Americans a year. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ This comes only days after a doctor told her family that she had influenza, prescribed her ibuprofen and instructed her to rest for 10 days at home. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ "For her, it wasn't even [the flu]. It was just three days and she was dead," Keila Lino Alcaraz, the girl’s mother, told ABC News ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ However, according to Alyssa’s death certificate officials from Tulare County say she died from cardiac arrest and septic shock, which is the body’s extreme response to an infection. "Sepsis can rapidly cause tissue damage, organ failure and death," according to the Centers for Disease Control and Prevention. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Alyssa’s mother says she won’t take any legal action but she hopes medical officials will develop tests for rare cases like Alyssa’s to prevent misdiagnosing other patients. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ "I have mixed emotions. I know doctors and clinics are so overwhelmed with flu cases right now. My thing is, yeah, I could point fingers, but as a mother, I missed it, too," she said.
Abc, Doctor, and Family: California Girl Dies From
 Deadly Infection After Being
 Misdiagnosed With Flu
 @balleralert
California Girl Dies From Deadly Infection After Being Misdiagnosed With Flu - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ A 12-year-old California girl lost her life after her mother said a doctor misdiagnosed a deadly infection with the flu. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Dec. 17, Alyssa Alcaraz died in Kaweah Delta Medical Center in Visalia, California, from an infection called sepsis which kills more than 250,000 Americans a year. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ This comes only days after a doctor told her family that she had influenza, prescribed her ibuprofen and instructed her to rest for 10 days at home. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ "For her, it wasn't even [the flu]. It was just three days and she was dead," Keila Lino Alcaraz, the girl’s mother, told ABC News ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ However, according to Alyssa’s death certificate officials from Tulare County say she died from cardiac arrest and septic shock, which is the body’s extreme response to an infection. "Sepsis can rapidly cause tissue damage, organ failure and death," according to the Centers for Disease Control and Prevention. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Alyssa’s mother says she won’t take any legal action but she hopes medical officials will develop tests for rare cases like Alyssa’s to prevent misdiagnosing other patients. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ "I have mixed emotions. I know doctors and clinics are so overwhelmed with flu cases right now. My thing is, yeah, I could point fingers, but as a mother, I missed it, too," she said.

California Girl Dies From Deadly Infection After Being Misdiagnosed With Flu - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ A 12-year-old...

Billboard, Christmas, and Definitely: Jhene Aiko Opens the WAYS Foundation In Remembrance of Her Late Brother @balleralert ousu Jhene Aiko Opens the WAYS Foundation In Remembrance of Her Late Brother - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There are plenty of things to smile about, and singer-songwriter Jhene Aiko is definitely sure to spark a few smiles with her latest endeavor, the 'WAYS Foundation'. The 29-year-old launched the charity over Christmas weekend, in honor of her late brother, Miyagi, who passed away, after battling cancer, back in 2012. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Through the newly-established organization, Aiko has set out to assist cancer patients and the families of those in need, providing not only financial but emotional comfort and support, as well. She made her first generous donation to Lily Olive Cosby, a five-year-old girl from Eagle Rock, California, who was recently diagnosed with leukemia. Aiko visited Cosby's home with a $15,000 check in hand to cover the little one's medical bills. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ When speaking with Billboard, Aiko says, "This Christmas, I decided to gift my family with the 'WAYS Foundation,' something my family and I have had in the works since the passing of my brother," She expresses. "I decided to make a donation on my family's behalf, in which we plan to continue to help people and families affected by cancer." ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to Billboard, the name of the foundation gains its significance from the phrase "Why aren't you smiling?"-which is something that her brother once tweeted during his battle with the disease.
Billboard, Christmas, and Definitely: Jhene Aiko Opens the WAYS
 Foundation In Remembrance of
 Her Late Brother
 @balleralert
 ousu
Jhene Aiko Opens the WAYS Foundation In Remembrance of Her Late Brother - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There are plenty of things to smile about, and singer-songwriter Jhene Aiko is definitely sure to spark a few smiles with her latest endeavor, the 'WAYS Foundation'. The 29-year-old launched the charity over Christmas weekend, in honor of her late brother, Miyagi, who passed away, after battling cancer, back in 2012. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Through the newly-established organization, Aiko has set out to assist cancer patients and the families of those in need, providing not only financial but emotional comfort and support, as well. She made her first generous donation to Lily Olive Cosby, a five-year-old girl from Eagle Rock, California, who was recently diagnosed with leukemia. Aiko visited Cosby's home with a $15,000 check in hand to cover the little one's medical bills. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ When speaking with Billboard, Aiko says, "This Christmas, I decided to gift my family with the 'WAYS Foundation,' something my family and I have had in the works since the passing of my brother," She expresses. "I decided to make a donation on my family's behalf, in which we plan to continue to help people and families affected by cancer." ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to Billboard, the name of the foundation gains its significance from the phrase "Why aren't you smiling?"-which is something that her brother once tweeted during his battle with the disease.

Jhene Aiko Opens the WAYS Foundation In Remembrance of Her Late Brother - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There are plenty of thin...

Children, Memes, and Anxiety: 8-Year-Old Underwent 13 Surgeries All at the Expense of His Mother's Alleged Mental lness @balleralert 8-Year-Old Underwent 13 Surgeries All at the Expense of His Mother’s Alleged Mental Illness-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ An 8-year-old Dallas boy has had 13 surgeries and appeared at 323 hospital visits, all due to his mother lying about him being ill. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ 34-year-old Kaylene Bowen took her son, Christopher, to another hospital visit last month, but this time, medical professionals noticed that something wasn’t right. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Christopher, who uses a wheelchair, was examined by doctors who determined that nothing was wrong with the boy. The staff at the Children’s Medical Center in Dallas contacted Child Protective Services, which resulted in Bowen’s arrest. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ “She was always saying Christopher was sick. Every single week. Every single month. She would always say, "Something’s wrong. He has this. He has that,” the father, Ryan Crawford, told the Star-Telegram of Bowen. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Despite the boy’s perfect health, he has been on a lung transplant list, connected to oxygen tanks and even had a feeding tube inserted in him. Bowen also alleged via a GoFundMe account that Christopher had cancer. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Crawford tried to get custody of his son but his attempt fell on deaf ears after Bowen accused him of not wanting to face the “reality” about their son’s health. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Dr. Marc Feldman reportedly told WFAA that Bowen’s behavior is consistent with the mental disorder Munchhausen syndrome by proxy. The disease is characterized as a caregiver who makes up “an illness or injury in a person under his or her care, such as a child, an elderly adult, or a person who has a disability.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The cause of this is reportedly tied to low self-esteem, stress, anxiety or a cry for attention. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ “These mothers tend to be master deceivers and liars,” Feldman said. “They’re very skilled at what they do.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Bowen is being held on a $150,000 bond after being charged with injury to a child with serious bodily injury.
Children, Memes, and Anxiety: 8-Year-Old Underwent 13 Surgeries
 All at the Expense of His Mother's
 Alleged Mental lness
 @balleralert
8-Year-Old Underwent 13 Surgeries All at the Expense of His Mother’s Alleged Mental Illness-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ An 8-year-old Dallas boy has had 13 surgeries and appeared at 323 hospital visits, all due to his mother lying about him being ill. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ 34-year-old Kaylene Bowen took her son, Christopher, to another hospital visit last month, but this time, medical professionals noticed that something wasn’t right. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Christopher, who uses a wheelchair, was examined by doctors who determined that nothing was wrong with the boy. The staff at the Children’s Medical Center in Dallas contacted Child Protective Services, which resulted in Bowen’s arrest. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ “She was always saying Christopher was sick. Every single week. Every single month. She would always say, "Something’s wrong. He has this. He has that,” the father, Ryan Crawford, told the Star-Telegram of Bowen. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Despite the boy’s perfect health, he has been on a lung transplant list, connected to oxygen tanks and even had a feeding tube inserted in him. Bowen also alleged via a GoFundMe account that Christopher had cancer. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Crawford tried to get custody of his son but his attempt fell on deaf ears after Bowen accused him of not wanting to face the “reality” about their son’s health. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Dr. Marc Feldman reportedly told WFAA that Bowen’s behavior is consistent with the mental disorder Munchhausen syndrome by proxy. The disease is characterized as a caregiver who makes up “an illness or injury in a person under his or her care, such as a child, an elderly adult, or a person who has a disability.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The cause of this is reportedly tied to low self-esteem, stress, anxiety or a cry for attention. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ “These mothers tend to be master deceivers and liars,” Feldman said. “They’re very skilled at what they do.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Bowen is being held on a $150,000 bond after being charged with injury to a child with serious bodily injury.

8-Year-Old Underwent 13 Surgeries All at the Expense of His Mother’s Alleged Mental Illness-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ An 8-year-...

Bad, Memes, and Control: 41 WORRYING WILL NEVER CHANGE THE OUTCOME @MILLIONAIRE MENTOR Who are the worriers? Why are some people so prone to "what if disease," while others merely worry about something when it happens? But you may ask… why do they worry? People worry because they think something bad will happen or could happen, so they activate a “hyper-vigilant” strategy of worry and think that 'if I worry I can prevent this bad thing from happening or catch it early. (Which is BS) So here millmentor is bringing some WORRY-busting steps!👇 ✔️Make a list of your worries. Identify what you are worried about. (Easy one) ✔️Analyze the list. Look at whether your worry is productive or unproductive. - Productive worry is one that you can do something about right now. - Unproductive worry is one which you can't do anything about. ✔️Embrace uncertainty. Once you have isolated your unproductive worries, it's time to identify what you need to accept in order to get over them. Acceptance means noticing that uncertainty exists and letting go and focusing on the things that you can control, enjoy, or appreciate. ✔️Make yourself uncomfortable. Worriers feel that they can't tolerate discomfort, but if you practice discomfort, you will accomplish a lot more. So GET UNCOMFORTABLE. ✔️Remember that it's never as bad as you think it will be. Anxiety or worry is all about anticipation. The 'what ifs' are always way worse than how you feel when something actually happens. - Did you like my millmentor tips? Drop a comment below and let me know what you think!👇👇 - worry whatif success mindset millionairementor
Bad, Memes, and Control: 41
 WORRYING WILL NEVER
 CHANGE THE OUTCOME
 @MILLIONAIRE MENTOR
Who are the worriers? Why are some people so prone to "what if disease," while others merely worry about something when it happens? But you may ask… why do they worry? People worry because they think something bad will happen or could happen, so they activate a “hyper-vigilant” strategy of worry and think that 'if I worry I can prevent this bad thing from happening or catch it early. (Which is BS) So here millmentor is bringing some WORRY-busting steps!👇 ✔️Make a list of your worries. Identify what you are worried about. (Easy one) ✔️Analyze the list. Look at whether your worry is productive or unproductive. - Productive worry is one that you can do something about right now. - Unproductive worry is one which you can't do anything about. ✔️Embrace uncertainty. Once you have isolated your unproductive worries, it's time to identify what you need to accept in order to get over them. Acceptance means noticing that uncertainty exists and letting go and focusing on the things that you can control, enjoy, or appreciate. ✔️Make yourself uncomfortable. Worriers feel that they can't tolerate discomfort, but if you practice discomfort, you will accomplish a lot more. So GET UNCOMFORTABLE. ✔️Remember that it's never as bad as you think it will be. Anxiety or worry is all about anticipation. The 'what ifs' are always way worse than how you feel when something actually happens. - Did you like my millmentor tips? Drop a comment below and let me know what you think!👇👇 - worry whatif success mindset millionairementor

Who are the worriers? Why are some people so prone to "what if disease," while others merely worry about something when it happens? But you ...