🔥 | Latest

Being Alone, Bad, and Dancing: You Don't Need To Be In A Relationship To Enjoy Valentine's Day @balleralert You Don’t Need To Be In A Relationship To Enjoy Valentine’s Day - blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Valentine’s Day is not just for couples. If you want to enjoy, you can either do it alone or call up your girls and you ladies can do something together. Don’t let the day “couple’s day” bring you down. Just look at it as a day of being all about you and only you. Just because it’s Valentine’s Day, doesn’t mean that you have are exempt from celebrating this day of love. Here are a few things that you can do for yourself today! ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Treat Yourself- Enjoy a box of assorted chocolates and a glass of wine as a gift to yourself. Who said that chocolates had to come from someone else? Relax in a nice bubble bath, soft music, wine, and of course your box of chocolate. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Enjoy Some Relaxation- Spa days are great any time of the month, but what better time than on Valentine’s Day. Relax and let all of the stress of the world go, while enjoying a deep tissue massage, manicure, pedicure, and a facial. Who says you can’t look good for yourself? ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Girls Night Out- Get the girls together and go out for dinner and dancing! Nothing like drinks, girl talk and boy bashing to make you realize that being single isn’t half bad after all! ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Meet Someone New- Open yourself up to a new romance .Valentine’s Day isn’t just for those who have been in a relationship, it’s also for those who are looking to start one. Get out there and mingle, who knows you may meet the man of your dreams. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It really doesn’t matter what you do, just don’t sit at home and mope around. Valentine’s Day is a day for lovers, those who’ve been in love and those who are looking for true love. Get out there and experience it! ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Valentine’s Day!
Being Alone, Bad, and Dancing: You Don't Need To Be In A Relationship To
 Enjoy Valentine's Day
 @balleralert
You Don’t Need To Be In A Relationship To Enjoy Valentine’s Day - blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Valentine’s Day is not just for couples. If you want to enjoy, you can either do it alone or call up your girls and you ladies can do something together. Don’t let the day “couple’s day” bring you down. Just look at it as a day of being all about you and only you. Just because it’s Valentine’s Day, doesn’t mean that you have are exempt from celebrating this day of love. Here are a few things that you can do for yourself today! ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Treat Yourself- Enjoy a box of assorted chocolates and a glass of wine as a gift to yourself. Who said that chocolates had to come from someone else? Relax in a nice bubble bath, soft music, wine, and of course your box of chocolate. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Enjoy Some Relaxation- Spa days are great any time of the month, but what better time than on Valentine’s Day. Relax and let all of the stress of the world go, while enjoying a deep tissue massage, manicure, pedicure, and a facial. Who says you can’t look good for yourself? ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Girls Night Out- Get the girls together and go out for dinner and dancing! Nothing like drinks, girl talk and boy bashing to make you realize that being single isn’t half bad after all! ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Meet Someone New- Open yourself up to a new romance .Valentine’s Day isn’t just for those who have been in a relationship, it’s also for those who are looking to start one. Get out there and mingle, who knows you may meet the man of your dreams. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It really doesn’t matter what you do, just don’t sit at home and mope around. Valentine’s Day is a day for lovers, those who’ve been in love and those who are looking for true love. Get out there and experience it! ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Valentine’s Day!

You Don’t Need To Be In A Relationship To Enjoy Valentine’s Day - blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Valentine’s Day is not just for coup...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Advice, Crazy, and God: Quincy Jones Admits to Having 22 Girlfriends, Says They All Know of Each Other @balleralert Quincy Jones Admits to Having 22 Girlfriends, Says They All Know of Each Other - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ After three marriages, QuincyJones is sure that he’s done with the faithful life. In fact, the divorcee has 22 girlfriends to prove it. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In an interview with GQ Magazine, the 84-year-old entertainment mogul opened up about his love life, and none of us were mentally prepared for what he had to say. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “I got twenty-two girlfriends,” he chuckles. “I was married three times, man. Was told not to marry actresses or singers. I ended up with two actresses—Peggy Lipton and Nastassja Kinski, and a superstar model. I didn’t listen to all the advice.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However—despite his marital past, Jones doesn’t have any plans to tie the knot again anytime soon, especially since it’d be extremely hard to narrow down such a high number of girlfriends to just one wife, right? We’d imagine so. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ When asked if he was serious about having 22 lovers, Jones blatantly says, “Hell yeah. Everywhere. Cape Town. Cairo. Stockholm-she’s coming in next week. Brazil-Belo Horizonte, São Paulo, and Rio. Shanghai, [I’ve] got a great girl over there, too, man.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Surprisingly, all of the women know of each other, as Jones proudly admits that “he doesn’t lie.” And, allegedly, most of them are between the ages of 28 and 42. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ So, when the question came up about if he’d ever date someone around his age, Jones was quick to shut that down. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “Are you crazy?” He gives the interviewer a startled look. “For what, man? There’s nothing; there’s no upside. You gotta be kidding. I got me some technology out there that keeps [the] fat and old away from here. [It] buzzes if they’re too old. But, you’d be surprised. These women, the young ones, are aggressive now. Oh my God, they’re fearless, man. All over the world.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As you can see, Mr. Jones is still a rolling stone, even in his old age.
Advice, Crazy, and God: Quincy Jones Admits to Having 22
 Girlfriends, Says They All Know of
 Each Other
 @balleralert
Quincy Jones Admits to Having 22 Girlfriends, Says They All Know of Each Other - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ After three marriages, QuincyJones is sure that he’s done with the faithful life. In fact, the divorcee has 22 girlfriends to prove it. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In an interview with GQ Magazine, the 84-year-old entertainment mogul opened up about his love life, and none of us were mentally prepared for what he had to say. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “I got twenty-two girlfriends,” he chuckles. “I was married three times, man. Was told not to marry actresses or singers. I ended up with two actresses—Peggy Lipton and Nastassja Kinski, and a superstar model. I didn’t listen to all the advice.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However—despite his marital past, Jones doesn’t have any plans to tie the knot again anytime soon, especially since it’d be extremely hard to narrow down such a high number of girlfriends to just one wife, right? We’d imagine so. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ When asked if he was serious about having 22 lovers, Jones blatantly says, “Hell yeah. Everywhere. Cape Town. Cairo. Stockholm-she’s coming in next week. Brazil-Belo Horizonte, São Paulo, and Rio. Shanghai, [I’ve] got a great girl over there, too, man.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Surprisingly, all of the women know of each other, as Jones proudly admits that “he doesn’t lie.” And, allegedly, most of them are between the ages of 28 and 42. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ So, when the question came up about if he’d ever date someone around his age, Jones was quick to shut that down. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “Are you crazy?” He gives the interviewer a startled look. “For what, man? There’s nothing; there’s no upside. You gotta be kidding. I got me some technology out there that keeps [the] fat and old away from here. [It] buzzes if they’re too old. But, you’d be surprised. These women, the young ones, are aggressive now. Oh my God, they’re fearless, man. All over the world.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As you can see, Mr. Jones is still a rolling stone, even in his old age.

Quincy Jones Admits to Having 22 Girlfriends, Says They All Know of Each Other - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ After three marri...

Birthday, College, and Community: 9 Things You May Not Know About Martin Luther King Jr. @balleralert 9 Things You May Not Know About Martin Luther King Jr. - Blogged By @Climb_This_Hill ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Every year on January 15th marks a special remembrance for Martin Luther King Jr. as we celebrate his birthday and achievements as a civil rights leader and activist in black history. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As we remember his heroic efforts today, there are still a few things you may not have known about MLK. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 1. Martin Luther King Jr. was born Micheal King, and both he and his father changed their name after the German Protestant leader, Martin Luther. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 2. Martin Luther King Jr. began taking college classes full-time at Atlanta’s Morehouse College at the age of 15 and graduated with his Ph.D. at 25. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 3. On October 14th, 1964, at age 35, Martin Luther King Jr. became the youngest man to receive a Nobel Peace Prize for resisting racial inequality through non-violence. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 4. King donated all of the $54,123 (worth about $400,000 today) of his Nobel Peace Prize award to the Civil Rights movement. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 5. He was the first African American to be granted a national federal holiday. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 6. Over 1,000 streets in the U.S are named after Martin Luther King Jr. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 7. MLK was arrested more than 20 times for his non-violent civil rights protests. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 8. King won a Grammy for ‘Best Spoken Word Album’ for “Why I Oppose the War in Vietnam.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 9. In 2006, the Martin Luther King Jr. National Monument in Washington, D.C. was marked the first monument on the National Mall dedicated to an African-American. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Birthday, MLK. We appreciate all that you’ve done for the black culture and the sacrifices you’ve made to help create equality inside and out of our oppressed community.
Birthday, College, and Community: 9 Things You May Not Know
 About Martin Luther King Jr.
 @balleralert
9 Things You May Not Know About Martin Luther King Jr. - Blogged By @Climb_This_Hill ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Every year on January 15th marks a special remembrance for Martin Luther King Jr. as we celebrate his birthday and achievements as a civil rights leader and activist in black history. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As we remember his heroic efforts today, there are still a few things you may not have known about MLK. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 1. Martin Luther King Jr. was born Micheal King, and both he and his father changed their name after the German Protestant leader, Martin Luther. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 2. Martin Luther King Jr. began taking college classes full-time at Atlanta’s Morehouse College at the age of 15 and graduated with his Ph.D. at 25. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 3. On October 14th, 1964, at age 35, Martin Luther King Jr. became the youngest man to receive a Nobel Peace Prize for resisting racial inequality through non-violence. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 4. King donated all of the $54,123 (worth about $400,000 today) of his Nobel Peace Prize award to the Civil Rights movement. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 5. He was the first African American to be granted a national federal holiday. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 6. Over 1,000 streets in the U.S are named after Martin Luther King Jr. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 7. MLK was arrested more than 20 times for his non-violent civil rights protests. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 8. King won a Grammy for ‘Best Spoken Word Album’ for “Why I Oppose the War in Vietnam.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ 9. In 2006, the Martin Luther King Jr. National Monument in Washington, D.C. was marked the first monument on the National Mall dedicated to an African-American. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Birthday, MLK. We appreciate all that you’ve done for the black culture and the sacrifices you’ve made to help create equality inside and out of our oppressed community.

9 Things You May Not Know About Martin Luther King Jr. - Blogged By @Climb_This_Hill ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Every year on January 15th marks a spec...

Bad, Disappointed, and Life: IT COSTS $0.00 TO BE A DECENT PERSON. The real problem stems from a long line of narcissism and a huge lack of consideration for anyone other than one’s self. 👇Here are TWO Golden Rules we should all consider when striving to be a decent human being: ✔️Treat others the way you would like to be treated. This one seems to be especially concerning because I feel like I hear it so often. People will be venting about friend drama and mention all of the ways that they have been wounded, and yet, I can't help but notice that often times the person wounded fails to recognize that their own behavior can be just as wounding and upsetting as the person they are venting about. This rule is simple enough, if you wouldn't want somebody to treat, talk about or speak to you in a specific way, the you should make damn sure that you follow your own rules. ✔️Recognize that time is limited. In other words, let us not take people for granted. We are all so quick to assume that we will have certain people in our lives forever but the truth is that we never really know for sure what tomorrow will bring.If somebody is important to you, show them. If you value a person's place in your life your actions will show it and you will exercise great consideration, dedication and loyalty towards them. - It's not hard to be a decent and considerate person and yet it's not something we see people practicing regularly. Though I've been disappointed by so many people, I've finally come to terms with the fact that as a society and especially millennials just don't value loyalty and compassion and consideration like we used to. Time to change! - values good bad millionairementor
Bad, Disappointed, and Life: IT COSTS $0.00 TO
 BE A DECENT PERSON.
The real problem stems from a long line of narcissism and a huge lack of consideration for anyone other than one’s self. 👇Here are TWO Golden Rules we should all consider when striving to be a decent human being: ✔️Treat others the way you would like to be treated. This one seems to be especially concerning because I feel like I hear it so often. People will be venting about friend drama and mention all of the ways that they have been wounded, and yet, I can't help but notice that often times the person wounded fails to recognize that their own behavior can be just as wounding and upsetting as the person they are venting about. This rule is simple enough, if you wouldn't want somebody to treat, talk about or speak to you in a specific way, the you should make damn sure that you follow your own rules. ✔️Recognize that time is limited. In other words, let us not take people for granted. We are all so quick to assume that we will have certain people in our lives forever but the truth is that we never really know for sure what tomorrow will bring.If somebody is important to you, show them. If you value a person's place in your life your actions will show it and you will exercise great consideration, dedication and loyalty towards them. - It's not hard to be a decent and considerate person and yet it's not something we see people practicing regularly. Though I've been disappointed by so many people, I've finally come to terms with the fact that as a society and especially millennials just don't value loyalty and compassion and consideration like we used to. Time to change! - values good bad millionairementor

The real problem stems from a long line of narcissism and a huge lack of consideration for anyone other than one’s self. 👇Here are TWO Golde...

Golden Globes, Lit, and Memes: Oprah Winfrey Delivers Thought- Provoking Golden Globes Speech @balleralert Read More: www.balleralert.com Oprah Winfrey Delivers Thought-Provoking Golden Globes Speech - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Last night, Oprah Winfrey became the first black woman to receive the honorable ‘Cecil B. DeMille Award’ at the 75th Annual Golden Globe Awards. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The 63-year-old lit up the night when she delivered a thought-provoking acceptance speech that made the moment even more powerful. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Following the recent launch of the TimesUp anti-sexual misconduct group, hundreds of industry heavy-hitter women graced the red carpet in all black as a silent scream for justice against sexual assault and abuse in Hollywood. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ During her speech, Winfrey expressed how overwhelming it was to be granted such an esteemed award. But, she wasted no time in shedding light on something that it has often been dimmed on-abuse. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “It's the insatiable dedication to uncovering the absolute truth that keeps us from turning a blind eye to corruption and to injustice. To tyrants and victims, and secrets and lies," she says. "What I know for sure is that speaking your truth is the most powerful tool we all have." ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A victim of sexual abuse herself, Winfrey admits that she has been inspired by all of the stories of the women who have come forward. She later highlighted Recy Taylor, a woman of color who was brutally raped by six white men in 1944. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “She lived as we all have lived, too many years in a culture broken by brutally powerful men. For too long, women have not been heard or believed if they dare speak the truth to the power of those men. But their time is up. Their time is up.” Winfrey boasts.......to read the rest log on to BallerAlert.com (clickable link on profile)
Golden Globes, Lit, and Memes: Oprah Winfrey Delivers Thought-
 Provoking Golden Globes Speech
 @balleralert
 Read More: www.balleralert.com
Oprah Winfrey Delivers Thought-Provoking Golden Globes Speech - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Last night, Oprah Winfrey became the first black woman to receive the honorable ‘Cecil B. DeMille Award’ at the 75th Annual Golden Globe Awards. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The 63-year-old lit up the night when she delivered a thought-provoking acceptance speech that made the moment even more powerful. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Following the recent launch of the TimesUp anti-sexual misconduct group, hundreds of industry heavy-hitter women graced the red carpet in all black as a silent scream for justice against sexual assault and abuse in Hollywood. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ During her speech, Winfrey expressed how overwhelming it was to be granted such an esteemed award. But, she wasted no time in shedding light on something that it has often been dimmed on-abuse. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “It's the insatiable dedication to uncovering the absolute truth that keeps us from turning a blind eye to corruption and to injustice. To tyrants and victims, and secrets and lies," she says. "What I know for sure is that speaking your truth is the most powerful tool we all have." ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A victim of sexual abuse herself, Winfrey admits that she has been inspired by all of the stories of the women who have come forward. She later highlighted Recy Taylor, a woman of color who was brutally raped by six white men in 1944. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “She lived as we all have lived, too many years in a culture broken by brutally powerful men. For too long, women have not been heard or believed if they dare speak the truth to the power of those men. But their time is up. Their time is up.” Winfrey boasts.......to read the rest log on to BallerAlert.com (clickable link on profile)

Oprah Winfrey Delivers Thought-Provoking Golden Globes Speech - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Last night, Oprah Winfrey became t...

Click, Internet, and Money: AT&T 4:50 AM polygonfighter Hey what the fuck happened to all the net neutrality coverage This shit is still happening people, and all of the sudden its disappeared from my dash almost entirely over night eykonto I don't know why, but I think people are automatically being unfollowed from the Net Neutrality tag. It happens to me every time l try to follow it. I'll follow the tag, come back 20 minutes later & I'll for some reason have unfollowed the tag automatically. I think this may be happening to a majority of people in an attempt to silence the resistance. Please take a screen shot of this post in case it gets deleted polygonfighter hey yeah can yall reblog this cause this is very important. Tumblr is ACTIVELY trying to silence out outrage at this by making us incapable of seeing coverage of events. We're all gonna have to come together and step up about this. Every little note counts, spread the word, dont give in so easily AT&T 4:50 AM polygonfighter I just checked this and i can CONFIRM that tumblr AUTOMATICALLY MAKES YOU UNFOLLOW THE NET NEUTRALITY TAGS AFTER 20 MINUTES Please spread the word! Screen shot this post just in case it gets deleted!! bristlee1 There is a reason that happens. Tumblr is OWNED by Verizon who is a leader in throwing money at getting rid of Net Neutrality. They have spent literally millions to bring it down so that they can charge you more, slow down your internet and block you from sites they do not deem appropriate. Keep sending in letters, emails and making phone calls. IF you post about it ADD links for FS! What is Net Neutrality: click here (X) How to fight back, doing NOTHING is not an option: https://www.battleforthenet.com/ http://act.freepress.net/sign/internet_lifeline_fcc/? source-website action%3Fsource%3Dwebsite actio ns https://www.aclu.org/issues/free-speech/dont- dismantle-net-neutrality https://petitions.whitehouse.gov/petition/do-not- repeal-net-neutrality Tumblr automatically makes you unfollow the net neutrality tags after 20 minutes (x-post r/netneutrality)
Click, Internet, and Money: AT&T
 4:50 AM
 polygonfighter
 Hey what the fuck happened
 to all the net neutrality
 coverage
 This shit is still happening people, and all of the
 sudden its disappeared from my dash almost entirely
 over night
 eykonto
 I don't know why, but I think people are automatically
 being unfollowed from the Net Neutrality tag. It
 happens to me every time l try to follow it. I'll follow
 the tag, come back 20 minutes later & I'll for some
 reason have unfollowed the tag automatically. I think
 this may be happening to a majority of people in an
 attempt to silence the resistance. Please take a
 screen shot of this post in case it gets deleted
 polygonfighter
 hey yeah can yall reblog this cause this is very
 important. Tumblr is ACTIVELY trying to silence out
 outrage at this by making us incapable of seeing
 coverage of events. We're all gonna have to come
 together and step up about this.
 Every little note counts, spread the word, dont give
 in so easily
 AT&T
 4:50 AM
 polygonfighter
 I just checked this and i can CONFIRM that tumblr
 AUTOMATICALLY MAKES YOU UNFOLLOW THE
 NET NEUTRALITY TAGS AFTER 20 MINUTES
 Please spread the word! Screen shot this post just in
 case it gets deleted!!
 bristlee1
 There is a reason that happens. Tumblr is OWNED by
 Verizon who is a leader in throwing money at getting
 rid of Net Neutrality. They have spent literally
 millions to bring it down so that they can charge you
 more, slow down your internet and block you from
 sites they do not deem appropriate. Keep sending in
 letters, emails and making phone calls. IF you post
 about it ADD links for FS!
 What is Net Neutrality: click here (X)
 How to fight back, doing NOTHING is not an
 option:
 https://www.battleforthenet.com/
 http://act.freepress.net/sign/internet_lifeline_fcc/?
 source-website action%3Fsource%3Dwebsite actio
 ns
 https://www.aclu.org/issues/free-speech/dont-
 dismantle-net-neutrality
 https://petitions.whitehouse.gov/petition/do-not-
 repeal-net-neutrality
Tumblr automatically makes you unfollow the net neutrality tags after 20 minutes (x-post r/netneutrality)

Tumblr automatically makes you unfollow the net neutrality tags after 20 minutes (x-post r/netneutrality)

Confidence, Definitely, and Energy: MLLIONLIREMENTOR CONFIDENCE MAKES YOU SEXY A few reasons why confidence is the most attractive quality a person can possess. - Confidence is an asset that shines through personal relationships, your own relationship with yourself and relations in the workplace. Everyone respects a person with confidence because with it, you are basically investing your heart and soul into something you feel passionately about. ✔️It shows how you feel about yourself. If you aren't going to have confidence in yourself, why would anyone else? You can't expect people to support you unconditionally if you do not believe in yourself wholeheartedly. If you aren't secure in who you are as a person, how can you ever move forward in life with ease?🤔 ✔️It asserts power and knowledge. If you aren't confident in your views and convictions, how can you expect others to listen to what you have to say? If you don't believe what you are selling, no one else will either. People aren't fools and will know when you are faking it. They can smell bullsh*t a mile away and are definitely not afraid to call you out on it. If you want people to listen to what you have to say, you must show confidence and engage them in whatever it is you are trying to say. ✔️It encourages positive thinking. Who wants to be around someone who is constantly negative all of the time? No one, that's for damn sure. ✔️It shows leadership. There is no way to even trust someone's ability to lead you if that person isn't confident in his or her own motives. Leaders must have confidence so that the people looking up to them feel secure, motivated and driven. ✔️It draws people to you. Confidence creates an aura that draws people in. Because many people lack high self-esteems, they are intrigued by people who have high levels of confidence. They want to learn how these people live their lives with hopes of emulating their energy. - confidence sexy motivation millionairementor
Confidence, Definitely, and Energy: MLLIONLIREMENTOR
 CONFIDENCE
 MAKES YOU
 SEXY
A few reasons why confidence is the most attractive quality a person can possess. - Confidence is an asset that shines through personal relationships, your own relationship with yourself and relations in the workplace. Everyone respects a person with confidence because with it, you are basically investing your heart and soul into something you feel passionately about. ✔️It shows how you feel about yourself. If you aren't going to have confidence in yourself, why would anyone else? You can't expect people to support you unconditionally if you do not believe in yourself wholeheartedly. If you aren't secure in who you are as a person, how can you ever move forward in life with ease?🤔 ✔️It asserts power and knowledge. If you aren't confident in your views and convictions, how can you expect others to listen to what you have to say? If you don't believe what you are selling, no one else will either. People aren't fools and will know when you are faking it. They can smell bullsh*t a mile away and are definitely not afraid to call you out on it. If you want people to listen to what you have to say, you must show confidence and engage them in whatever it is you are trying to say. ✔️It encourages positive thinking. Who wants to be around someone who is constantly negative all of the time? No one, that's for damn sure. ✔️It shows leadership. There is no way to even trust someone's ability to lead you if that person isn't confident in his or her own motives. Leaders must have confidence so that the people looking up to them feel secure, motivated and driven. ✔️It draws people to you. Confidence creates an aura that draws people in. Because many people lack high self-esteems, they are intrigued by people who have high levels of confidence. They want to learn how these people live their lives with hopes of emulating their energy. - confidence sexy motivation millionairementor

A few reasons why confidence is the most attractive quality a person can possess. - Confidence is an asset that shines through personal rela...